New video posted: Translation - making proteins from DNA - decoding mRNA to make the protein

This is the second of two videos on how cells make proteins using DNA. In the first video, I looked at the first step, which is making the messenger RNA (mRNA) a process called transcription - Transcription - making proteins from DNA - the mRNA.

In this video, I will guide you through the process of producing the protein from the mRNA, also known as translation. I will look at the coding problem (how many mRNA bases do you need to code from an amino acid), the number of reading frames in a DNA molecule, and how the cell produces protein from the mRNA.

  

If you would like to support my blogging efforts, then please feel free to buy me a coffee at https://www.buymeacoffee.com/drnickm

Blog Bonus: Free information sheet summarising the video and defining the key terms - download.

 

Additional Reading

The video was produced with help from the following resources:

• 📗 - The Biosciences Glossary
• 📗 - Molecular Biology of the Cell (Alberts) - (affiliate link)
• 📗 - Molecular Cell Biology (Lodish) - (affiliate link)
• 📗 - Biochemistry (Stryer) - (affiliate link)

Protein sequence to DNA - Degeneracy calculation

I have had some questions about the reverse translation of protein to DNA and degeneracy...

The protein sequence is THERIGHTREADINGFRAME

It is 20 amino acids, and therefore, you will need 60 bases to encode it. So....

Protein Seq:  T  H  E  R  I  G  H  T  R  E  A  D  I  N  G  F  R  A  M  E 
DNA Seq:     ACNCAYGARMGNATHGGNCAYACNMGNGARGCNGAYATHAAYGGNTTYMGNGCNATGGAR    
Full DNA:    ACACACGAACGAATAGGACACACACGAGAAGCAGACATAAACGGATTCCGAGCAATGGAA
               T  T  G  T  C  T  T  T  T  G  T  T  C  T  T  T  T  T     G
               G        G  T  C     G  G     C     T     C     G  C
               C        C     G     C  C     G           G     C  G
                      AGG            AGG                     AGG
                        A              A                       A
Number codons: 4  2  2  6  3  4  2  4  6  2  4  2  3  2  4  2  6  4  1  2

So, 4 x 2 x 2 x 6 x 3 x 4 x 2 x 4 x 6 x 2 x 4 x 2 x 3 x 2 x 4 x 2 x 6 x 4 x 1 x 2 = 2,038,431,744 or 2 x 10⁹ possible DNA sequences would encode the protein sequence.

This is a big number; however, compared to the total number of possible DNA sequences you could have for a 60-base sequence, it is small.

The total number of DNA sequences you could have for a 60 base sequence is 4 x 4 x 4.... sixty times, or 4⁶⁰, which is equal to 1.3 x 10³⁶ possible sequences. Of those 1.3 x 10³⁶ sequences only 2,038,431,744 would encode THERIGHTREADINGFRAME. Or in percentage terms, (2,038,431,744 / 1.3 x 10³⁶) x 100 = 0.0000000000000000000000002% (2 x 10^-25%) of all the possible sequences would encode THERIGHTREADINGFRAME.

You may find the following video useful where I explain the above:

If you would like to support my blogging efforts, then please feel free to buy me a coffee at https://www.buymeacoffee.com/drnickm

Additional Resources

• 📗 - Biochemistry (Stryer) (affiliate link)
• 📗 - Principles of Biochemistry (Lehninger) (affiliate link)
• 📗 - Molecular Biology of the Cell (Alberts) (affiliate link)
• 📗 - Molecular Cell Biology (Lodish) (affiliate link)
• 📗 - Maths and Chemistry Refresher for Life and Biomedical Scientists
• 📗 - Catchup Chemistry (affiliate link)
• 📗 - Catchup Maths and Stats (affiliate link)