Saturday, 31 October 2009

Recent changes to PubMed

Some time in the past week the PubMed was updated.

The training site used in the CMB2005 informatics practical (which is running from Monday 26 October, 2009 to Friday 20 November, 2009) has been updated to reflect the PubMed changes. It is just unfortunate that the changes occurred between groups 1 and 2 taking the initial training.

The update to PubMed has not changed the way the training session works, and has not changed the assessment. The new instructions on the CMB2005 informatics training site are sufficient to allow anyone in group 1 to easily complete the assessment. (There have, so far, been no changes made to any of the other systems we use in the training or the assessment - famous last words....) In fact, the only thing that has really changed with PubMed is the look and feel of the site (one exception to this is if you use Safari browser, please see below).

A problem with PubMed and Safari: This problem is beyond my control and there is no fix I can put in place, and this only seems to happen on Safari on the Mac. When you have a list of search results up and you click on a link to read the abstract, if you click on the browser back-button to return to the list of results you will see this:

Safari pubmed back button problem

Clicking on the Safari browser back button when using PubMed now gives a 'form' warning - just click the Send button

all you have to do is click on the Send button.

Thursday, 29 October 2009

Why isn't it on Blackboard? (Or, eleven reasons why I don't use Blackboard.)

One question I have been asked, many times, is "why isn't this lecture/assessment etc. on Blackboard?". Well, there are a number of reasons....
Blackboard is an old technology and cannot do a lot of the things I want to do with my teaching. In fact, the technology in Blackboard dates back to the 1990s, and is very web 1.0 (we are now said to be web 2.0). Some of the things Blackboard can't do are:
  1. There is no way to bulk upload lectures.
  2. It is not possible to generate 'static' links to lecture notes etc. so therefore I cannot email the class a link to download a file in a single click. All I would be able to do is send an email that says new material has been posted, and then you would have to login to Blackboard to find it.
  3. There is no way in Blackboard to provide you with the feedback on assessments you want. I have 3 choices on Blackboard: a) No feedback or mark; b) Just a mark; c) Mark and a lot of feedback. So what is wrong with choice c? Well, it is not possible to delay feedback being sent, it can only be given when you complete an assessment. Hence, if the rest of the class is still doing the assessment I cannot do c, and that just leaves a or b, which would give you insufficient feedback.
  4. The technology in Blackboard does not allow for interactive tests as I use in CMB2005.
  5. The technology in Blackboard does not allow for the construction and management of large sites used for teaching, i.e. CMB2005.
  6. Blackboard does not allow for the construction of the types of assessment (with feedback) I use in BGM1001 and CMB2005.
  7. Blackboard does not allow for the easy creation of interactive pages with embedded material (e.g. additional notes and videos as seen for some of my lectures).
  8. There is no push technology in Blackboard. You always have to go to find information. If you subscribe to the rss feed on this blog you would receive automatic notifications in your rss newsreader of updates, new notes and links to articles.
  9. If you are in your second or third years, try and find your lectures notes from last year on Blackboard? All my notes are online back to 2001.
  10. Posting to this blog has taken the length of time it has taken me to write this. No time wasted, no hassle, easy editing, and you will know about this within 10 minutes of posting, and be able to go straight to it using a direct link, as opposed to digging through Blackboard.
  11. By using Twitter and this Blog I can post a short note on line in a matter of seconds. If I find an interesting paper or news story, a quick tweet, and it is there. This is not possible with Blackboard (in reverse, as I post this to the Blog a Tweet gets sent out automatically so if you are following me on Twitter you would know in seconds).
As some of you may know I am chairman of the Blackboard Steering Group and one of the reasons I accepted the position is because I firmly believe in the use of technology in teaching, and I am aware of the problems with Blackboard. I am now working with the University to get Blackboard improved, and as soon as Blackboard can do the majority of the thing I need for teaching, I will use it.
Meanwhile, links to all my material are on Blackboard, and are in the relevant sections, so just follow them...
If you have any questions, please email me: n.j.morris@ncl.ac.uk.

Tuesday, 6 October 2009

Finding references given in lectures

I have been asked how you can track down papers online when a lecturer gives a paper reference as, for example:

Clin Med. (2003) 3, 333-7

The easiest way to track this down is to use 'Single Citation Matcher' (as you were taught in CMB2005).

Go to pubmed and the link can be found in the left hand menu. Alternatively, follow this direct link:
http://www.ncbi.nlm.nih.gov/corehtml/query/static/citmatch.html

On the page enter the required information, so using the above reference, Clin Med. (2003) 3, 333-7, you should end up with:

Single citation manager

Click the 'Go' button and you should be taken to the paper (and any link to the full paper if available).

Abstract1

The abstract for the paper - don't forget there may be a link to the full paper on the far righthand side of the page.

Monday, 5 October 2009

CMB2005: Degeneracy calculation

I have had a couple of questions about reverse translation of protein to DNA, and degeneracy....

The protein sequence is: THERIGHTREADINGFRAME

It is 20 amino acids, and therefore you will need 60 bases to encode it. So....

Protein Seq:  T  H  E  R  I  G  H  T  R  E  A  D  I  N  G  F  R  A  M  E 
DNA Seq:     ACNCAYGARMGNATHGGNCAYACNMGNGARGCNGAYATHAAYGGNTTYMGNGCNATGGAR    
Full DNA:    ACACACGAACGAATAGGACACACACGAGAAGCAGACATAAACGGATTCCGAGCAATGGAA
               T  T  G  T  C  T  T  T  T  G  T  T  C  T  T  T  T  T     G
               G        G  T  C     G  G     C     T     C     G  C
               C        C     G     C  C     G           G     C  G
                      AGG            AGG                     AGG
                        A              A                       A
Number codons: 4  2  2  6  3  4  2  4  6  2  4  2  3  2  4  2  6  4  1  2
So, 4 x 2 x 2 x 6 x 3 x 4 x 2 x 4 x 6 x 2 x 4 x 2 x 3 x 2 x 4 x 2 x 6 x 4 x 1 x 2 = 2,038,431,744 or 2 x 109 possible DNA sequences would encode the protein sequence.

This is a big number, however, compared to the total number of possible DNA sequences you could have for a 60 base sequence, it is small.

The total number of DNA sequences you could have for a 60 base sequence is 4 x 4 x 4.... sixty times, or 460, which is equal to 1.3 x 1036 possible sequences. Of those 1.3 x 1036 sequences only 2,038,431,744 would encode THERIGHTREADINGFRAME. Or in percentage terms, (2,038,431,744 / 1.3 x 1036) x 100 = 0.0000000000000000000000002% (2 x 10-25%) of all the possible sequences would encode THERIGHTREADINGFRAME.

Sunday, 4 October 2009

Calculating Dilutions

Blog Post Bonus: A free eBook on dilutions is available on Gumroad
I have received a number of emails about how to dilution calculations in the BGM1001 assessment....
The type of question is:

You have been asked to dilute a 10 mg/ml solution to give 5 ml of a 1.5 mg/ml solution.

How many ml of water would you use?

How many ml of the stock protein solution would you use?

The way I would work this out is by saying that 5 ml of 1.5 mg/ml contains 5 x 1.5 mg = 7.5 mg.

If the stock is 10 mg/ml then I need to take a volume that would give 7.5 mg. So, the number of ml of the stock I need is 7.5 / 10 = 0.75 ml (that is, 0.75 ml of a 10 mg/ml solution contains 7.5 mg).

Therefore, I have 0.75 ml of the stock, and the final volume is 5 ml, so we need to add 5 - 0.75 = 4.25 ml of water.

The answer:

How many ml of water would you use? 4.25 ml

How many ml of the stock protein solution would you use? 0.75 ml

Although I prefer to work it out as above you can use a formula:

M1V1 = M2V2

Where:
M1 = Concentration 1
V1 = Volume 1
M2 = Concentration 2
V2 = Volume 2
Therefore:
M1 = Concentration 1 = 10 mg/ml
V1 = Volume 1 = Unknown X
M2 = Concentration 2 = 1.5 mg/ml
V2 = Volume 2 = 5 ml

or:
M1V1 = M2V2 10 mg/ml x Unknown X = 1.5 mg/ml x 5 ml

Rearranging to solve for Unknown X:

Unknown X = (1.5 mg/ml x 5 ml) / 10 mg/ml Therefore, Unknown X = 0.75 ml

Using the formula is the same as the first solution, but in the first solution I don't have to remember the formula....

Blog Post Bonus: A free eBook on dilutions is available on Gumroad
Fill out my online form.
There are tons of Wufoo features to help make your forms awesome.